comparison of Haemoglobin beta subunit gene (HBB gen
Instructions on comparison of Haemoglobin beta subunit gene (HBB gene):
Download the sequence labelled “human hbb” gene uploaded on canvas.
go to www.ncbi.nlm.nih.gov
select blast, then select nucleotide Blast Or simply click on this link: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome
Under Choose File, upload the text file named: “human hbb.txt”. You may also open the text file using MS word or notepad and then copy and paste the gene sequence onto the query sequence. You may also just copy and paste the following sequences onto the window.
ATGGTGTACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAA
Under organism: type “Pan” (Pan stands for chimpanzee) and select the taxid: 9596
select “somewhat similar sequences” under “Program selection”, optimize for…
Hit Blast, wait for the result to come back and select the best match that also describes it as the haemoglobin beta subunit..
*Note: Most of the time, the best match is shown as the first match. However, sometimes the program may display a partial match first that may obscure your result. You should select the one with the highest % identity match with the highest “query cover” % – as close to 100% as possible, to be the one that is your closest match. For from this particular blast, there are several sequences that have 100% identity but with only 70% Query cover. You should be careful NOT to select those over the sequences with higher % query cover.
What is the exact number of sequence matched between the Pan HBB and human HBB gene? What is the % identities match?
